SKU: 5793116117
Ships within 48 hours · Estimated delivery Sep 15 - Sep 20
glutathione iv vial Injection in New Orleans Flavor:Watermelon Brzz Ice Glutathione Quantification GSSG/GSH Quantification Glutone 1000 15 Tablets Online Shopping
Glutathione Quantification GSSG/GSH Quantification Kit II Dojindo
CRISPR/Cas9 generation of ∆ ADH5 and ∆ GCLM cell lines HCT116 ∆ ADH5 , ∆ GCLM , ∆ TP53 ∆ ADH5 , and ∆ ADH5 ∆ GCLM cell lines were generated by targeting exon 3 of ADH5 (sgRNA: TGCTGGAATTGTGAAAGTGTT) and exon 1 of GCLM (sgRNA: ACGGGGAACCTGCTGAACTG) in the corresponding parental cell lines
Glutone 1000 15 Tablets Online Shopping
Flavor:Watermelon Brzz Ice
Table 3 lists the five most-cited articles, each accumulating between 72 and 149 citations
US$ 25.32
US$ 29.35
US$ 25.07
