SKU: 42486296106
Ships within 48 hours · Estimated delivery Oct 31 - Nov 5
glutathione iv vial Injection in Arcadia, Beverly Hills and Los Angeles County Flavor:Watermelon Brzz Ice Glutathione Quantification GSSG/GSH Quantification Glutone 1000 15 Tablets Online Shopping
Glutathione Quantification GSSG/GSH Quantification Kit II Dojindo
CRISPR/Cas9 generation of ∆ ADH5 and ∆ GCLM cell lines HCT116 ∆ ADH5 , ∆ GCLM , ∆ TP53 ∆ ADH5 , and ∆ ADH5 ∆ GCLM cell lines were generated by targeting exon 3 of ADH5 (sgRNA: TGCTGGAATTGTGAAAGTGTT) and exon 1 of GCLM (sgRNA: ACGGGGAACCTGCTGAACTG) in the corresponding parental cell lines
Glutone 1000 15 Tablets Online Shopping
Flavor:Watermelon Brzz Ice
Table 3 lists the five most-cited articles, each accumulating between 72 and 149 citations
US$ 21.43
US$ 23.52
US$ 24.97
US$ 29.83
US$ 23.83
US$ 26.29
US$ 26.64
US$ 24.86
