SKU: 13423663823
Ships within 48 hours · Estimated delivery Oct 31 - Nov 5
glutathione iv vial IV: Before and After Flavor:Watermelon Brzz Ice Glutathione Quantification GSSG/GSH Quantification Glutone 1000 15 Tablets Online Shopping
Glutathione Quantification GSSG/GSH Quantification Kit II Dojindo
CRISPR/Cas9 generation of ∆ ADH5 and ∆ GCLM cell lines HCT116 ∆ ADH5 , ∆ GCLM , ∆ TP53 ∆ ADH5 , and ∆ ADH5 ∆ GCLM cell lines were generated by targeting exon 3 of ADH5 (sgRNA: TGCTGGAATTGTGAAAGTGTT) and exon 1 of GCLM (sgRNA: ACGGGGAACCTGCTGAACTG) in the corresponding parental cell lines
Glutone 1000 15 Tablets Online Shopping
Flavor:Watermelon Brzz Ice
Table 3 lists the five most-cited articles, each accumulating between 72 and 149 citations
US$ 22.57
US$ 20.55
US$ 26.52
US$ 20.47
US$ 26.86
US$ 23.59
US$ 29.26
